Mature sequence mml-miR-199a-3p

Accession numberMIMAT0006232
IDmml-miR-199a-3p
Stem-Loop mml-mir-199a-2
Sequence
acaguagucugcacauugguua
Get sequence
Deep sequencing178627 reads, 9 experiments
Database links
Predicted targets
QuickGO function

References

1