Mature sequence mml-miR-199a-5p

Accession numberMIMAT0006231
IDmml-miR-199a-5p
Stem-Loop mml-mir-199a-2
Sequence
cccaguguucagacuaccuguuc
Get sequence
Deep sequencing15027 reads, 9 experiments
Database links
Predicted targets
QuickGO function

References

1