Mature sequence mml-miR-140-5p

Accession numberMIMAT0006197
IDmml-miR-140-5p
Stem-Loop mml-mir-140
Sequence
cagugguuuuacccuaugguag
Get sequence
Deep sequencing74722 reads, 9 experiments
Database links
Predicted targets
QuickGO function

References

1