Mature sequence mml-miR-139-3p

Accession numberMIMAT0006196
IDmml-miR-139-3p
Stem-Loop mml-mir-139
Sequence
ggagacgcggcccuguuggagu
Get sequence
Deep sequencing39278 reads, 9 experiments
Database links
Predicted targets
QuickGO function

References

1