Mature sequence mml-let-7b-5p

Accession numberMIMAT0006152
IDmml-let-7b-5p
Stem-Loop mml-let-7b
Sequence
ugagguaguagguugugugguu
Get sequence
Deep sequencing13764277 reads, 9 experiments
Database links
Predicted targets
QuickGO function

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).