Mature sequence mdo-miR-1541

Accession numberMIMAT0006140
IDmdo-miR-1541
Stem-Loop mdo-mir-1541
Sequence
uggugugcucguuuggaugugg
Get sequence
Deep sequencing1794466 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References

1