Mature sequence ptc-miR1446a

Accession numberMIMAT0006004
IDptc-miR1446a
Stem-Loop ptc-MIR1446a
Sequence
uucugaacucucucccucaa
Get sequence
Deep sequencing reads, experiments

References

1
PMID:18363789 "Stress-responsive microRNAs in Populus" Lu S, Sun YH, Chiang VL Plant J. 55:131-151(2008).