Mature sequence mdv1-miR-M13

Accession numberMIMAT0005985
IDmdv1-miR-M13
Stem-Loop mdv1-mir-M13
Sequence
gcauggaaacguccugggaaa
Get sequence
Deep sequencing reads, experiments

References

1
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).