Mature sequence hsa-miR-664a-3p

Accession numberMIMAT0005949
IDhsa-miR-664a-3p
Previous IDshsa-miR-664;hsa-miR-664-3p
Stem-Loop hsa-mir-664a
Sequence
uauucauuuauccccagccuaca
Get sequence
Deep sequencing39183 reads, 152 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).