Mature sequence hsa-miR-1292-5p

Accession numberMIMAT0005943
IDhsa-miR-1292-5p
Previous IDshsa-miR-1292
Stem-Loop hsa-mir-1292
Sequence
ugggaacggguuccggcagacgcug
Get sequence
Deep sequencing2541 reads, 93 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).