Mature sequence hsa-miR-548h-5p

Accession numberMIMAT0005928
IDhsa-miR-548h-5p
Previous IDshsa-miR-548h
Stem-Loop hsa-mir-548h-1 hsa-mir-548h-2 hsa-mir-548h-3 hsa-mir-548h-4 hsa-mir-548h-5
Sequence
aaaaguaaucgcgguuuuuguc
Get sequence
Deep sequencing29178 reads, 146 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).
2
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).