Mature sequence hsa-miR-1272

Accession numberMIMAT0005925
IDhsa-miR-1272
Stem-Loop hsa-mir-1272
Sequence
gaugaugauggcagcaaauucugaaa
Get sequence
Deep sequencing291 reads, 28 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).