Mature sequence hsa-miR-1262

Accession numberMIMAT0005914
IDhsa-miR-1262
Stem-Loop hsa-mir-1262
Sequence
augggugaauuuguagaaggau
Get sequence
Deep sequencing2273 reads, 116 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).