Mature sequence hsa-miR-1247-5p

Accession numberMIMAT0005899
IDhsa-miR-1247-5p
Previous IDshsa-miR-1247
Stem-Loop hsa-mir-1247
Sequence
acccgucccguucguccccgga
Get sequence
Deep sequencing6124 reads, 136 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).