Mature sequence hsa-miR-1245a

Accession numberMIMAT0005897
IDhsa-miR-1245a
Previous IDshsa-miR-1245
Stem-Loop hsa-mir-1245a
Sequence
aagugaucuaaaggccuacau
Get sequence
Deep sequencing18 reads, 13 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).