Mature sequence hsa-miR-1244

Accession numberMIMAT0005896
IDhsa-miR-1244
Stem-Loop hsa-mir-1244-1 hsa-mir-1244-2 hsa-mir-1244-3 hsa-mir-1244-4
Sequence
aaguaguugguuuguaugagaugguu
Get sequence
Deep sequencing208 reads, 29 experiments

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).