Mature sequence hsa-miR-1303

Accession numberMIMAT0005891
IDhsa-miR-1303
Stem-Loop hsa-mir-1303
Sequence
uuuagagacggggucuugcucu
Get sequence
Deep sequencing4145 reads, 154 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).