Mature sequence hsa-miR-1293

Accession numberMIMAT0005883
IDhsa-miR-1293
Stem-Loop hsa-mir-1293
Sequence
uggguggucuggagauuugugc
Get sequence
Deep sequencing173 reads, 36 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).