Mature sequence hsa-miR-1291

Accession numberMIMAT0005881
IDhsa-miR-1291
Stem-Loop hsa-mir-1291
Sequence
uggcccugacugaagaccagcagu
Get sequence
Deep sequencing3545 reads, 129 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).