Mature sequence hsa-miR-1289

Accession numberMIMAT0005879
IDhsa-miR-1289
Stem-Loop hsa-mir-1289-1 hsa-mir-1289-2
Sequence
uggaguccaggaaucugcauuuu
Get sequence
Deep sequencing204 reads, 59 experiments
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).