Mature sequence hsa-miR-1286

Accession numberMIMAT0005877
IDhsa-miR-1286
Stem-Loop hsa-mir-1286
Sequence
ugcaggaccaagaugagcccu
Get sequence
Deep sequencing659 reads, 50 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).