Mature sequence hsa-miR-1285-3p

Accession numberMIMAT0005876
IDhsa-miR-1285-3p
Previous IDshsa-miR-1285
Stem-Loop hsa-mir-1285-1 hsa-mir-1285-2
Sequence
ucugggcaacaaagugagaccu
Get sequence
Deep sequencing17819 reads, 154 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).