Mature sequence hsa-miR-1204

Accession numberMIMAT0005868
IDhsa-miR-1204
Stem-Loop hsa-mir-1204
Sequence
ucguggccuggucuccauuau
Get sequence
Deep sequencing3 reads, 3 experiments
Predicted targets

References

1
PMID:18314482 "The identification of microRNAs in a genomically unstable region of human chromosome 8q24" Huppi K, Volfovsky N, Runfola T, Jones TL, Mackiewicz M, Martin SE, Mushinski JF, Stephens R, Caplen NJ Mol Cancer Res. 6:212-221(2008).