Mature sequence mmu-miR-1192

Accession numberMIMAT0005850
IDmmu-miR-1192
Stem-Loop mmu-mir-1192
Sequence
aaacaaacaaacagaccaaauu
Get sequence
Deep sequencing39 reads, 19 experiments
Predicted targets

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).