Mature sequence mmu-miR-1191a

Accession numberMIMAT0005849
IDmmu-miR-1191a
Previous IDsmmu-miR-1191
Stem-Loop mmu-mir-1191a
Sequence
cagucuuacuauguagcccua
Get sequence
Deep sequencing536 reads, 61 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).