Mature sequence mmu-miR-466j

Accession numberMIMAT0005848
IDmmu-miR-466j
Stem-Loop mmu-mir-466j
Sequence
ugugugcaugugcauguguguaa
Get sequence
Deep sequencing9380 reads, 99 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).