Mature sequence mmu-miR-1190

Accession numberMIMAT0005847
IDmmu-miR-1190
Stem-Loop mmu-mir-1190
Sequence
ucagcugagguuccccucuguc
Get sequence
Deep sequencing12 reads, 10 experiments
Predicted targets

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).