Mature sequence mmu-miR-467f

Accession numberMIMAT0005846
IDmmu-miR-467f
Stem-Loop mmu-mir-467f
Sequence
auauacacacacacaccuaca
Get sequence
Deep sequencing13915 reads, 110 experiments
Predicted targets

References

1
PMID:17989215 "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" Calabrese JM, Seila AC, Yeo GW, Sharp PA Proc Natl Acad Sci U S A. 104:18097-18102(2007).