Mature sequence hsa-miR-1178-3p

Accession numberMIMAT0005823
IDhsa-miR-1178-3p
Previous IDshsa-miR-1178
Stem-Loop hsa-mir-1178
Sequence
uugcucacuguucuucccuag
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:17922033 "MicroRNA expression signature of human sarcomas" Subramanian S, Lui WO, Lee CH, Espinosa I, Nielsen TO, Heinrich MC, Corless CL, Fire AZ, van de Rijn M Oncogene. 27:2015-2026(2008).