Mature sequence hsa-miR-1271-5p

Accession numberMIMAT0005796
IDhsa-miR-1271-5p
Previous IDshsa-miR-1271
Stem-Loop hsa-mir-1271
Sequence
cuuggcaccuagcaagcacuca
Get sequence
Deep sequencing15617 reads, 150 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).
3
PMID:19508715 "Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing" Nygaard S, Jacobsen A, Lindow M, Eriksen J, Balslev E, Flyger H, Tolstrup N, Moller S, Krogh A, Litman T BMC Med Genomics. 2:35(2009).