Mature sequence bna-miR167c

• Accession number: MIMAT0005628
• ID: bna-miR167c
• Sequence: ugaagcugccagcaugaucua
• Stem-Loop: bna-MIR167c

References

1. PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).
2. PMID:22138974 "Small RNA profiling in two Brassica napus cultivars identifies microRNAs with oil production- and development-correlated expression and new small RNA classes" Zhao YT, Wang M, Fu SX, Yang WC, Qi CK, Wang XJ Plant Physiol. 158:813-823(2012).