Mature sequence bna-miR169k

Accession numberMIMAT0005622
IDbna-miR169k
Stem-Loop bna-MIR169k
Sequence
uagccaaggaugacuugccugc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:17659282 "Cloning and characterization of microRNAs from Brassica napus" Wang L, Wang MB, Tu JX, Helliwell CA, Waterhouse PM, Dennis ES, Fu TD, Fan YL FEBS Lett. 581:3848-3856(2007).
2