Mature sequence mml-miR-1232

Accession numberMIMAT0005587
IDmml-miR-1232
Stem-Loop mml-mir-1232
Sequence
cugaccccgaccaccccgcag
Get sequence
Deep sequencing28 reads, 4 experiments
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).