Mature sequence hsa-miR-1228-5p

Accession numberMIMAT0005582
IDhsa-miR-1228-5p
Previous IDshsa-miR-1228*
Stem-Loop hsa-mir-1228
Sequence
gugggcgggggcaggugugug
Get sequence
Deep sequencing170 reads, 47 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).