Mature sequence hsa-miR-1226-5p

Accession numberMIMAT0005576
IDhsa-miR-1226-5p
Previous IDshsa-miR-1226*
Stem-Loop hsa-mir-1226
Sequence
gugagggcaugcaggccuggaugggg
Get sequence
Deep sequencing236 reads, 32 experiments
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).