Mature sequence ptr-miR-1224-5p

Accession numberMIMAT0005568
IDptr-miR-1224-5p
Stem-Loop ptr-mir-1224
Sequence
gugaggacucgggagguggagggu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).