Mature sequence mcmv-miR-m88-1-5p

• Accession number: MIMAT0005551
• ID: mcmv-miR-m88-1-5p
• Previous IDs: mcmv-miR-m88-1*
• Stem-Loop: mcmv-mir-m88-1
• Sequence: augaccgacccccugacaucgg
• Deep sequencing: reads, experiments

References

1. PMID:17928340 "Discrete clusters of virus-encoded micrornas are associated with complementary strands of the genome and the 7.2-kilobase stable intron in murine cytomegalovirus" Buck AH, Santoyo-Lopez J, Robertson KA, Kumar DS, Reczko M, Ghazal P J Virol. 81:13761-13770(2007).
2. PMID:17942535 "Mouse cytomegalovirus microRNAs dominate the cellular small RNA profile during lytic infection and show features of posttranscriptional regulation" Dolken L, Perot J, Cognat V, Alioua A, John M, Soutschek J, Ruzsics Z, Koszinowski U, Voinnet O, Pfeffer S J Virol. 81:13771-13782(2007).