Mature sequence mcmv-miR-M23-2-5p

Accession numberMIMAT0005544
IDmcmv-miR-M23-2-5p
Previous IDsmcmv-miR-M23-2*
Stem-Loop mcmv-mir-M23-2
Sequence
ugaacguguccccuaucggugg
Get sequence
Deep sequencing reads, experiments

References

1
2
PMID:17942535 "Mouse cytomegalovirus microRNAs dominate the cellular small RNA profile during lytic infection and show features of posttranscriptional regulation" Dolken L, Perot J, Cognat V, Alioua A, John M, Soutschek J, Ruzsics Z, Koszinowski U, Voinnet O, Pfeffer S J Virol. 81:13771-13782(2007).