Mature sequence aga-miR-34

Accession numberMIMAT0005526
IDaga-miR-34
Stem-Loop aga-mir-34
Sequence
uggcagugugguuagcuggu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:17933784 "Anopheles gambiae miRNAs as actors of defence reaction against Plasmodium invasion" Winter F, Edaye S, Huttenhofer A, Brunel C Nucleic Acids Res. 35:6953-6962(2007).