Mature sequence rno-miR-466b-5p

Accession numberMIMAT0005278
IDrno-miR-466b-5p
Previous IDsrno-miR-466b
Stem-Loop rno-mir-466b-1 rno-mir-466b-2 rno-mir-466b-3 rno-mir-466b-4
Sequence
uauguguguguguauguccaug
Get sequence
Deep sequencing4728 reads, 293 experiments

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).