Mature sequence smo-miR1089

Accession numberMIMAT0005242
IDsmo-miR1089
Stem-Loop smo-MIR1089
Sequence
agaucaucuaggauuguuugc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).