Mature sequence smo-miR166b

Accession numberMIMAT0005221
IDsmo-miR166b
Stem-Loop smo-MIR166b
Sequence
ucggaccaggcuucauucccc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).