Mature sequence ppt-miR1054

Accession numberMIMAT0005172
IDppt-miR1054
Stem-Loop ppt-MIR1054
Sequence
uaaacccucucucuauuccug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).