Mature sequence pta-miR166c

Accession numberMIMAT0004995
IDpta-miR166c
Stem-Loop pta-MIR166c
Sequence
ccggaccaggcuucaucccag
Get sequence
Deep sequencing reads, experiments

References

1