Mature sequence pta-miR166b

Accession numberMIMAT0004994
IDpta-miR166b
Stem-Loop pta-MIR166b
Sequence
ucggaccaggcuucauucccc
Get sequence
Deep sequencing reads, experiments

References

1