Mature sequence pta-miR166a

Accession numberMIMAT0004993
IDpta-miR166a
Stem-Loop pta-MIR166a
Sequence
ucggaccaggcuucauucccc
Get sequence
Deep sequencing reads, experiments

References

1