Mature sequence hsa-miR-942-5p

Accession numberMIMAT0004985
IDhsa-miR-942-5p
Stem-Loop hsa-mir-942
Sequence
ucuucucuguuuuggccaugug
Get sequence
Deep sequencing2644 reads, 142 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).