Mature sequence hsa-miR-938

Accession numberMIMAT0004981
IDhsa-miR-938
Stem-Loop hsa-mir-938
Sequence
ugcccuuaaaggugaacccagu
Get sequence
Deep sequencing19 reads, 11 experiments
Predicted targets

References

1
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).