Mature sequence hsa-miR-509-3-5p

Accession number MIMAT0004975
ID hsa-miR-509-3-5p
Sequence 
uacugcagacguggcaaucaug
Get sequence
Stem-Loop hsa-mir-509-3

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17573847 "Analysis of gene expression in normal and neoplastic human testis: new roles of RNA" Novotny GW, Nielsen JE, Sonne SB, Skakkebaek NE, Rajpert-De Meyts E, Leffers H Int J Androl. 30:316-326(2007).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).