Mature sequence hsa-miR-920

Accession numberMIMAT0004970
IDhsa-miR-920
Stem-Loop hsa-mir-920
Sequence
ggggagcuguggaagcagua
Get sequence
Deep sequencing6 reads, 4 experiments
Predicted targets

References

1
PMID:17573847 "Analysis of gene expression in normal and neoplastic human testis: new roles of RNA" Novotny GW, Nielsen JE, Sonne SB, Skakkebaek NE, Rajpert-De Meyts E, Leffers H Int J Androl. 30:316-326(2007).